Information for Lmscaffold165.452

· Gene Ontology:


GO:0003677 GO:0006355


· KEGG information:


no information


· Enzyme Commission number (EC):


no information


· Gene family:


FLO_LFY/PF01698


· Interpro information:


Lmscaffold165.452


· Expression data: (root) (FPKM)


2500m3000m3500m4000m
0000


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend


· Protein sequence: (419 aa)


>Lmscaffold165.452
MDPQGFASGLFRWNPTRTIVPAPPPVHPPPQQPAPTPQTAAFGLRLGGLEGLFGPYGIRFYTAAKIAELGFTASTLVDMKDEELEEMMNSLSHIFMWELLVGERYGIKAAVRAERRRLQEEEEEESSRRRHLLLSAAGDSSAHHALDALSQEGLSEEPVQQDQTDAAGNNGGDGGGYWEVGQAGKMKKQQQQRRRKKTMMMTSVETDDYGNDGEDDDGMDHNGNGSGVLGTERQREHPFIVTEPGEVARGKKNGLDYLFHLYEQCREFLVQVQTIAKDRGEKCPTKVTNQVFRYAKKSGASYINKPKMRHYVHCYALHCLDEDASNALRRAFKERGENVGSWRQACYKPLVNIACRHGWDIDAVFNAHPRLSIWYVPTKLRQLCHLERNNAVAATAALVGGISCSGSSASGHGGDDMPY


· CDS sequence: (1260 bp)


>Lmscaffold165.452
ATGGATCCTCAAGGTTTCGCAAGTGGCTTATTCCGCTGGAACCCAACGAGAACAATTGTTCCAGCACCACCTCCGGTTCATCCACCACCGCAGCAACCGGCGCCAACACCACAAACGGCGGCTTTTGGGCTGCGACTCGGTGGTTTAGAGGGATTGTTTGGTCCTTATGGTATACGTTTCTACACGGCTGCGAAGATAGCTGAGTTAGGTTTTACGGCGAGTACGCTTGTGGATATGAAGGATGAGGAGCTTGAGGAGATGATGAATAGTCTCTCTCATATCTTTATGTGGGAGCTTCTCGTCGGTGAACGGTATGGTATTAAAGCTGCCGTTAGAGCTGAACGGAGACGATTGCAAGAAGAGGAAGAAGAAGAATCTTCTAGACGCCGTCATTTGCTACTCTCCGCCGCTGGTGATTCCAGTGCCCATCACGCTCTTGATGCTCTATCTCAAGAAGGGTTATCAGAGGAACCGGTGCAGCAAGACCAGACAGATGCGGCGGGGAATAACGGCGGAGACGGAGGAGGTTATTGGGAAGTAGGTCAAGCCGGAAAGATGAAGAAGCAACAACAGCAAAGACGGAGAAAGAAAACAATGATGATGACGTCAGTGGAAACAGACGATTATGGCAACGACGGTGAGGATGACGACGGAATGGATCATAACGGTAACGGAAGTGGTGTGTTGGGGACGGAGAGGCAAAGGGAGCATCCGTTTATTGTAACGGAGCCTGGGGAAGTAGCACGTGGCAAAAAGAACGGTTTAGATTATCTGTTCCATTTGTACGAACAATGCCGTGAGTTCCTTGTTCAGGTCCAGACTATTGCTAAAGACCGTGGCGAAAAATGCCCCACTAAGGTGACGAACCAAGTGTTTCGGTACGCAAAGAAATCTGGAGCGAGTTACATAAACAAGCCAAAAATGAGACACTACGTCCACTGTTACGCTCTTCACTGCCTAGACGAAGACGCCTCAAATGCTCTTCGAAGAGCGTTTAAAGAACGTGGCGAGAACGTTGGCTCGTGGCGTCAAGCTTGCTACAAGCCACTGGTTAACATAGCTTGTCGTCATGGTTGGGATATTGACGCTGTTTTTAACGCTCATCCTCGCCTCTCTATTTGGTATGTCCCAACTAAGCTGCGTCAGCTTTGTCATTTGGAGAGGAACAATGCGGTTGCTGCGACTGCGGCTTTGGTTGGTGGTATTAGTTGTTCCGGATCGTCTGCGTCTGGACATGGTGGCGACGATATGCCTTACTAG


· Genomic location:


scaffold165:3159706:3162605:+