Information for Lmscaffold234.149

· Gene Ontology:


no information


· KEGG information:


K12236: -


· Enzyme Commission number (EC):


no information


· Gene family:


zfNFX1/PF01422


· Interpro information:


Lmscaffold234.149


· Expression data: (root) (FPKM)


2500m3000m3500m4000m
3.99552.171523.777818.03902


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend


· Protein sequence: (1196 aa)


>Lmscaffold234.149
MGLIVFRVYYLGAQKASIAPTVTGTRSGTVFVESRKEMSTQIRRDKRGDGSGFNSQSSQQKWIPRSASTLVVVSVRSVSPNIDRNSESRDAGAASRPVYLQRQHNGSGPPPYNQHQRGSNIGPPNRQRRYNASGTLPDNQHQRSIIGPHPPNRQRRNNVSETQPDNQHQRSINIGPPPPNRQRRNNVLETQPDNQHRRSISIGKKVAKQENIVLIDPNLPQLVQEIQEKLLKSSIECMICYDKVGRSAHIWSCSSCYSIFHMNCIKRWARAPISVDLLAEKNQGDNWRCPGCQSVQLTSPKEICYRCFCAKRKDPPSDPYLTPHSCGEPCGKRLEKECAAAETTKEDICPHVCVLQCHPGPCPPCKAFAPPRSCPCGKKMVTTRCSERRSVLVCGQPCNMLLNCGRHQCERACHVGPCDPCQVLVNATCFCKKKVETVICGDMSVKGELNAEDGVYSCNFNCGKLLGCGNHFCSEVCHPGPCGDCDLLPGRVKTCYCGKTRLEEQIRQSCLDPIPSCSNICRKLLPCKLHTCSEVCHAGDCPPCLVQVNENCRCGSTSRTVECYITTSLETEKFVCTKPCGRKKNCGRHRCSERCCPLLNVKKNDLSGSWDPHICQIPCGKKLRCRKHACESLCHSGHCPSCLEMIFSDLTCACGRTSIPPPQPCGTPVPSCQLLCSIPQPCGHSVTHGCHFGDCPPCSAPVEKKCVGGHVVLRNIPCGLKDIRCNKICGKTRRCGMHACARTCHSEPCDNYNDSETGLQVTCGQTCGAPRRDCRHTCSALCHPSAPCPDLRCEFPVTITCSCGRITATVPCDAGGRNANGSYVDSAYDEASVLKKLPAPIQPVELSGNQIPHSQRKLSCDDECAKLERKRLLQDAFDITIPNLEALHFSENSAMTEIISDLYRRDPKWVMAVEERCKFLVLGKARGSPSALKVHVFCPMQKDKRETVRLIAERWKLAVSNAGWEPKRFTIVHVTPKSKPPTRIIGARGGGVSVGGPHPPSFDPLVDMDPGLVVSLLDLPREANISALVLRFGGECELVWLNDKNALAVFDDHARAATAMRRLDHGSVYHGAVVVQNSVQNPSLSNAWGKLPGGSSWGGQRGNPWKKAVIQETDYSWGAEDSPIKESSTAWRSAENTTPIVTSVNRWSVLEPEKVITPTLAPLSQTEEGSSSKAAGKQPVEGSSEEVVDDWEKVCD


· CDS sequence: (3591 bp)


>Lmscaffold234.149
ATGGGTTTGATTGTATTTCGTGTTTATTATCTAGGAGCGCAGAAAGCATCCATTGCTCCAACAGTGACGGGTACAAGATCTGGTACCGTATTTGTGGAGTCAAGGAAGGAGATGAGCACTCAAATCAGGAGAGATAAGAGGGGTGATGGGTCTGGATTCAATTCTCAGAGTTCTCAACAAAAGTGGATTCCTAGGAGCGCTTCTACCTTGGTGGTGGTAAGCGTGCGTTCTGTTTCTCCTAATATAGATAGGAATTCTGAAAGCCGTGATGCTGGTGCTGCATCCCGTCCTGTTTATTTGCAAAGGCAGCATAATGGTTCTGGTCCTCCTCCCTATAACCAGCACCAAAGGGGTAGTAACATTGGTCCACCTAATCGACAGAGAAGATACAACGCATCGGGAACTCTGCCTGATAACCAGCATCAAAGGAGCATAATTGGTCCACATCCGCCTAATCGACAAAGAAGAAATAATGTTTCAGAAACTCAGCCTGATAACCAGCATCAAAGGAGCATTAACATTGGTCCACCGCCGCCTAATCGACAAAGAAGAAATAATGTTTTGGAAACTCAGCCTGATAACCAACATCGAAGGAGCATTAGCATTGGGAAAAAAGTAGCTAAGCAGGAGAATATTGTGTTGATAGACCCGAACTTGCCTCAACTTGTTCAAGAGATACAGGAGAAGCTTTTGAAGAGTTCTATCGAGTGTATGATTTGTTATGACAAGGTTGGGCGCTCTGCTCATATCTGGTCGTGCTCCAGCTGTTATTCCATCTTCCATATGAATTGTATCAAGAGGTGGGCTCGGGCACCAATATCAGTCGATTTGCTGGCTGAGAAAAATCAAGGTGATAATTGGAGATGTCCAGGTTGCCAATCTGTACAGTTGACATCACCCAAAGAGATATGCTATCGGTGTTTTTGCGCAAAGAGAAAAGATCCACCTTCTGATCCATATTTGACTCCACACTCATGCGGGGAACCATGTGGGAAACGGCTGGAAAAAGAGTGTGCAGCAGCCGAGACGACGAAAGAGGATATTTGTCCTCATGTTTGTGTGTTGCAGTGTCACCCTGGTCCATGTCCTCCCTGTAAGGCGTTTGCTCCACCTCGTAGCTGTCCTTGTGGTAAGAAGATGGTTACTACTAGATGCTCCGAGCGGAGATCTGTTCTTGTTTGTGGCCAGCCTTGCAATATGCTTCTCAATTGCGGGCGCCACCAATGTGAAAGGGCATGTCACGTTGGCCCATGTGATCCTTGTCAGGTACTGGTAAACGCCACATGTTTCTGCAAGAAAAAAGTGGAGACTGTCATTTGCGGAGATATGAGTGTTAAGGGAGAGTTGAACGCAGAAGATGGTGTGTATTCCTGCAATTTTAATTGTGGGAAGCTGCTTGGATGTGGTAATCATTTCTGTTCCGAGGTTTGCCATCCTGGACCGTGTGGGGACTGTGACTTATTGCCCGGTAGAGTTAAGACGTGTTATTGTGGGAAAACACGTTTAGAAGAACAGATTAGGCAGAGTTGTTTGGACCCAATTCCTTCTTGTTCAAACATATGCAGGAAGCTTCTTCCTTGTAAGTTACATACTTGCAGTGAGGTGTGCCATGCAGGTGATTGCCCGCCTTGTCTAGTCCAGGTAAACGAGAACTGTCGGTGTGGATCAACATCCAGGACTGTGGAATGCTACATAACAACTTCTCTCGAGACAGAAAAGTTTGTGTGCACTAAGCCATGTGGGCGTAAGAAGAACTGCGGGAGACATAGATGTAGCGAGCGTTGTTGCCCTCTCTTGAACGTGAAGAAGAATGATCTATCTGGTTCTTGGGACCCACACATCTGCCAAATACCTTGTGGGAAGAAGCTTAGGTGCAGGAAGCATGCTTGTGAGTCTTTGTGTCACAGTGGCCATTGCCCTTCTTGTCTCGAGATGATTTTCAGTGATCTTACATGTGCATGTGGAAGAACTTCAATTCCTCCACCACAACCATGTGGTACACCTGTCCCTAGCTGCCAGCTTCTATGCTCGATTCCTCAGCCTTGCGGCCATTCTGTTACACATGGATGTCATTTTGGAGATTGCCCTCCTTGTTCTGCCCCCGTAGAAAAGAAATGTGTTGGTGGTCATGTGGTTCTCAGAAACATACCTTGTGGGTTAAAAGACATTAGATGTAATAAAATTTGTGGAAAGACAAGGCGTTGTGGTATGCATGCTTGTGCCAGAACTTGCCACTCAGAGCCTTGTGACAATTACAATGATTCTGAAACAGGTCTGCAGGTTACATGTGGACAGACGTGTGGTGCTCCTAGAAGAGATTGTAGACACACTTGTTCAGCACTCTGCCATCCTTCTGCGCCTTGCCCTGACCTAAGATGTGAATTTCCAGTCACGATTACTTGTTCATGTGGTCGCATAACAGCTACGGTTCCTTGTGATGCAGGAGGAAGAAATGCCAATGGTTCTTATGTTGATTCTGCATATGATGAAGCCTCTGTTTTGAAGAAGCTTCCAGCACCAATTCAGCCTGTTGAGTTGAGCGGAAACCAAATCCCTCACAGCCAGAGAAAGCTTTCGTGTGATGATGAATGTGCTAAGCTGGAGCGTAAGCGGCTTCTTCAAGATGCATTTGATATTACAATTCCAAATCTGGAGGCATTGCATTTTAGCGAGAATTCTGCTATGACAGAGATTATTTCAGACCTTTATAGACGTGATCCAAAGTGGGTAATGGCTGTTGAGGAGCGCTGCAAGTTCCTGGTACTTGGAAAAGCCAGAGGAAGCCCTAGTGCCCTCAAGGTCCACGTCTTCTGCCCGATGCAGAAAGATAAAAGAGAAACAGTTCGGCTAATAGCTGAGAGGTGGAAACTTGCTGTTAGCAACGCTGGGTGGGAGCCAAAACGATTTACAATAGTTCACGTAACACCAAAGTCAAAACCGCCAACACGGATAATCGGAGCTAGAGGTGGTGGTGTCTCCGTAGGTGGTCCTCACCCGCCGTCCTTTGATCCACTAGTGGATATGGATCCTGGGCTTGTGGTTTCTTTACTAGATCTCCCAAGGGAAGCAAATATCAGCGCCTTGGTACTGAGATTTGGGGGTGAATGTGAGCTTGTTTGGCTAAATGACAAGAACGCTTTAGCCGTGTTTGATGACCATGCTCGTGCTGCCACTGCCATGAGGAGGCTTGACCATGGTTCAGTATACCATGGAGCCGTGGTTGTCCAAAACAGTGTGCAAAATCCATCACTCAGTAATGCGTGGGGGAAACTACCTGGTGGCTCATCTTGGGGTGGTCAAAGGGGAAATCCATGGAAGAAAGCTGTGATTCAGGAGACTGATTACTCCTGGGGAGCTGAAGATTCCCCCATCAAAGAATCATCTACTGCGTGGAGATCAGCAGAAAACACCACCCCAATTGTTACCTCAGTTAACCGTTGGAGCGTTCTGGAGCCTGAGAAGGTCATCACGCCCACTTTGGCTCCATTGTCTCAGACAGAAGAGGGAAGCAGTTCAAAAGCTGCCGGTAAACAACCGGTGGAAGGCTCCAGCGAAGAAGTGGTTGATGATTGGGAGAAGGTATGTGACTGA


· Genomic location:


scaffold234:1300437:1304206:+