Information for Lmscaffold237.101

· Gene Ontology:


GO:0003677


· KEGG information:


K14486: K14486, ARF; auxin response factor


· Enzyme Commission number (EC):


no information


· Gene family:


B3/PF02362; Auxin_resp/PF06507


· Interpro information:


Lmscaffold237.101


· Expression data: (root) (FPKM)


2500m3000m3500m4000m
38.426532.41546.41132.2552


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend


· Protein sequence: (601 aa)


>Lmscaffold237.101
MGGLIDLNVMETEEEETQTPSCGSVSPTSSSSASASVVSSGSGGVCLELWHACAGPLISLPKRGSLVLYFPQGHLEQAPDFSAAIYGLPPHVFCRILDVKLHADTATDEVYAQVSLLPESKDVERKVREGILDVDGGEDDYEVLKRSNTPHMFCKTLTASDTSTHGGFSVPRRAAEDCFPPLDYSQPRPSQELLARDLHGLEWRFRHIYRGQPRRHLLTTGWSAFVNKKKLVSGDAVLFLRGDDGKLRLGVRRASQIEGASAFSTQYTQNMNHNNFAEVAHAISTHSVFSIYYNPKASWSNFIIPAPKFLKIVDYPFCIGMRFKVRIESEDASERRSPGIITGISDLDPIRWPGSKWRCLLVRWDDIEANGNPQRVSPWEIEPSGSISNSASFITSGPKRSRIGFSSGKPDIPVSEGNRTTDFEEFLRFQRVLQGQEIFPGFINTSSDVGAGARRGRFKGTDFGDSYGFHKVLQGQETVPAYSINDNRQHGLSQRNIWCGPFQNFSTRILPPSVSSSPSSVLITNPNSPNGRPDDHHGGAGRCRLFGFPLTDEATIVASATVVPCVEGNSMKGVSAGQSNHHHAQGRDIYAMRDMLLDIAL


· CDS sequence: (435 bp)


>Lmscaffold237.101
ATGGAGGAGACGACATGGGAACAGAGATTACAAGCCATGACTCACATACTCACAAGCCCAGCAACGAAACCATCACTTTACTCTCAATTCTTCATCGGAAACCTAATTCCACGTTACATCTCGTGGGACTACCCTCCGATCTATTCGCGGACGCATCTCCGTCAATGGTGGGTTTCTCAATTCCTTAAAAGGGTACCCAGATTGGGGCTTCCTGATACCTCATGGAGGTCGAATTGCCCGTATTATCAGCCTCCGGCGACGGTTATGGCGATTGGAGTGGAGGAAGGAAAATGGGGAAGAGAAGAGAGGAGAGAGTATGCGAGGAAGAGACTAAGGAGGAAGAAATTAGTGAATGAAGTGAATCCTTATATACCTCTTTTAGTTCCAAACTTGCTTCTCTTTACTCTCTTGTTATGGGATCCTCTTCCTGAGTAA


· Genomic location:


scaffold237:504714:507933:-