Information for Lmscaffold246.15

· Gene Ontology:


no information


· KEGG information:


no information


· Enzyme Commission number (EC):


no information


· Gene family:


Methyltransf_23/PF13489; SWIB/PF02201; GATA/PF00320; Methyltransf_11/PF08241; Kinesin/PF00225; CPP1like/PF11833; Methyltransf_29/PF03141; bZIP_2/PF07716; Microtub_bd/PF16796; Plus3/PF03126; Epimerase/PF01370; FGGAP/PF01839; UPF0183/PF03676; GDP_Man_Dehyd/PF16363; DUF3490/PF11995; RmlD_sub_bind/PF04321; DUF1640/PF07798; DUF702/PF05142; Methyltransf_25/PF13649; bZIP_1/PF00170; GYF/PF02213


· Interpro information:


Lmscaffold246.15


· Expression data: (root) (FPKM)


2500m3000m3500m4000m
0000


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend


· Protein sequence: (175 aa)


>Lmscaffold246.15
MMSTNYPVFSSEPDLATPFSDFETCFTQWDISTLFSVFDSAIDLKPGFANDSGSINKSGSDVAPTKNTDERRKKRKLSNRESAKRSREKKQKHLQEMNMQLNQLNTQNRELSNQLRYVLYHCHQTKSENDRLRLENRILQDKVLNIRQVLMFCQMERSSSCATWPCTVQQDPTVL


· CDS sequence: (696 bp)


>Lmscaffold246.15
ATGGGAGAATCAGCAACACACTCAGAACATCACATGATGATTGGCTTTACAGATCCCATGAAAATTGATCCCAGAAGAGATCGGTTCCCATGCTGCATTGTCTGGACACCTCTCCCCTTCATTTCATGGCTGATTCCCTTCATCGGTCACGTGGGTATTTGCAGAGAAGACGGTGTCATCCTTGACTTTGCAGGACCTAATTTTGTATGTGTTGATAACTTTGCATTTGGAGCTGTGGCTAGATATGTCCAAATCAACAAGGAAAAGGAATCATCTGTTTCTTCCGGCGCATTTATGGTAAATGGTAAAAAGAGATGTGAGCAAGAAGAAGACAGTCATGAGAAAGAGACAACATGGGATGATGCACTGAGAAAAGGCACACAAGAGTACCAACACTACTCGTATAGTCTATTCACATGCAATTGTCATTCTTTTGTAGCCAATAACCTGAACCGTCTAGGAGTAAGGTCAGGCGGGTGGAATGTGGTGAATCTCGCAGCACTTGTGTTCGTCAAGGGACGTTGGGTTAGCAATGTAGCCATAGTAAAGTCCTTGTTGCCTCCAATCATAATTTACGCATTAGGAATCTTTCTGGGTGGTTGGACTTTTATAGTTTCCTGCTCGATTCTAGCGGTTTTGCTTACGAGTTGGTTCATTGTGGGAACATATTGCTTCAAGAAACTGATCCAGCTGTAG


· Genomic location:


scaffold246:108469:108996:-