Information for Lmscaffold28.222

· Gene Ontology:


no information


· KEGG information:


K09338: -


· Enzyme Commission number (EC):


no information


· Gene family:


HDZIP_N/PF04618; Homeobox_KN/PF05920; HALZ/PF02183; Homeobox/PF00046


· Interpro information:


Lmscaffold28.222


· Expression data: (root) (FPKM)


2500m3000m3500m4000m
3.307842.277218.750945.51111


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend


· Protein sequence: (282 aa)


>Lmscaffold28.222
MMLEKDDLGLSLGLNFSKKQMSLKSNPSVSVTPSSSSFGLLRRSSWNESFDSSVPKSDLSRRTFLRGIDVNRPPSTAEYGDEDAGVSSPNSTVSSSTGKRSEREEDTDPQESRGISDDEDSDNSRKKLRLSKDQSAILEETFKDHTTLNPKQKQALAKQLGLRARQVEVWFQNRRARTKLKQTELDCEFLRRCCENLTEENRRLQKEVTELRALKLSPKFYMHMSPPTTLTMCPSCEHVSVPPPQPPQVATSAHHLSLPVNAWAPTSRISHGWTFDALRHRS


· CDS sequence: (1425 bp)


>Lmscaffold28.222
ATGGTGGAATCAAAAAGCTCGAAGAAAACAACCCAATTGGGTAACAAAGAAGATCAAAACCCTAGAAAATTCTACTCTAGATTCCTCTTCAAAGCTCTTATCCTCGCCGTGCTCTGCGCCGTTGTACCTGTCTTCCTTTCTCAGACGCCGGAGCTCGCTAACCAAACCAGACTCCTTGAGCTTCTCCACCTTGTTTTAGTCGGAATCGCCGTCTCCTACGGCCTCTTCAGCCGTCGGAACCACGACAGAAGAGGAAGCAGAAATGATCATAAATCTGATCATAATAACAACAATTCGCAATCGTATGTGCCTAAGATTCTTGATGTATCCTCTGTTTTTAACGTGGATCACGAGAGTGAATCAGATGATTTCTCCGGCGATCAACGTAAGTTTCAGACATGGAGGAACAAGTACCATATGAGAATCCCTGACGTTGTTCATTTTAAAGATCACGAGACTCGTTTCGTCGATCGAGTTAGTTCAGAGAACAGACAAAAGCCTCTGCTTTTACCTGTTCGGAGTTTGAATTATTCGCGAGGATTAGATCTTGGAATCGGTAATTCCGGTCAATGGGAAAAGGTGAGATCTAAAATAGAACTCTTGAAGACTCTTGGTGATGATAACAGTGATGTTCTTCCTTCTCCGATTCCATGGAGGTCAAGATCATTATCAAAGGAGATTGAATCTCAACCGTTGATTAAGAATCTGACTACAGATGAATCACAGCCGTTGATCAAGAATCTGACACCATCGAGAAAGTCGACGCCTTTACCTACTCTGGCATCTGAATTTCATCCGCCTCCGCCTCCTCCTCCTCCGCCGCCGCCTCTACCGGCGTTTTATTATTCGGCTTCGAAAAAGGCTCCCGGAATCTACAGAGTTGAGAGGAGAGAAGCATCAGTTAACAAGAAGAAATTTGCAGGAGGTGAGTTTCATCCTCCTCCACCGCCTCCGCCTCCGCCTCCGCCTCCGCCGCCACCACCACCTCCGGCTGACTATTATAAGTCGCCACAAACGAAACTCAGAGTAAGCAGTGAACGGAGAAAATCATCGGAACAAAAGATGAAATTCGATGAACGTTCAGCTAAAAAGAACTCTACTAAAAAAGTATGGTGGTCTGCTCAAATCGTGGAATCCAAAGAAGAGAGAATTATTAGAGAAGAAACGAAGAAGAACGAACAAAGAAGTTTCTCTAGAAGTAAGGAATCGGAAGATGAAGAACATAGAAGAAGAGAAAATGAAATCCACGAAGATGATGAGAAGAAGATAGATGAGGTCCATGAGGAAGAAGTAGTTAGTGGAAGTGACGTGGACAAGAAGGCTGATGCGTTCATTGCAAAGTTCAGAGAACAGATTAGGTTACAGAGAATCGATTCTATCAAGAGATCTGCTTATAAGATCTCTGCAAATCCTCCTTCAAGGTAG


· Genomic location:


scaffold28:1416882:1418389:-