Information for Lmscaffold384.34

· Gene Ontology:


no information


· KEGG information:


no information


· Enzyme Commission number (EC):


no information


· Gene family:


PWI/PF01480; HATPase_c/PF02518; Chitin_bind_1/PF00187; adh_short_C2/PF13561; Glyco_hydro_19/PF00182; Pkinase/PF00069; KR/PF08659; Usp/PF00582; bZIP_2/PF07716; adh_short/PF00106; Response_reg/PF00072; HisKA/PF00512; RRM_1/PF00076; bZIP_1/PF00170; Pkinase_Tyr/PF07714; DUF674/PF05056; GGACT/PF06094


· Interpro information:


Lmscaffold384.34


· Expression data: (root) (FPKM)


2500m3000m3500m4000m


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend


· Protein sequence: (522 aa)


>Lmscaffold384.34
MGGGDSDTTMMERINSSSSSIPKQLSPNQHLNPALICSHQQQFRQSFTGNRAGAPPSIPPVSPYSQIPATLQPRHSRSLSQPSSFFSADSLPPLNPTPSPSISVSVEEKNGTGFSPYLPPSPFSMCHTSSSRNAGDGENLLPRKSHRRSNSDVTLGFSSKLNQNQKSPPLIPSRSLERSVSGGKASDWSNLVKEEPKEGFFKGRKSEGETAMDDVFTAYMNLDNIDVLNSFGGEDGKDGNENVKEMESTRGSGTKETNGGSCCSDSEGESSASGNMKAAVSSSSGVKRRAGGNIAPSSRHYRSVSMDSCFMGKLNFGDEVLPASSAKASPTNSGEGNSSAVCVEFGNGEFTPAEMKKISADEKLSEIAMADPKRVKRILANRVSAARSKERKTRFMAELEHKVQTLQTEATTLSAQLMHLQRDSMGLMNQNSELKFRLQAMEQQAQLRDALSEQLTAEVQRLKKMIGDPSHRQSDSNSEFNIPKLSLNPEMFQKLSISQLQHQQMQQSNQNSTMKPKYTSNE


· CDS sequence: (2775 bp)


>Lmscaffold384.34
ATGGCGGCTTCGACTTTGTACCCGCTCCTTTCGTTCATGAACCCTTCATATAGGCCTAGTTTAGTCGATAAAAGCAGTTTGGATACTCAGGTTCATCTATTCGCTGGCTCTGATTTAGTTGAATCACCTTTAGAATCGAGATTTCGTATAACTGGTAATATTAGTTCATGGATAGATTTGGATTCTGAAAATGAGATGAAGCGGATTGAGTCAGAAATCGCACTGAAGCAAGAAATAGCCTGGGCTAAGCATCTCTCCTTACGGTGTGAACCAGATCTTACATGGGTTGAAGGAAATGGAGACGTAAAAAAATTTCCTTCCTCCAGGAGTATACTACCATCTACAAATTCACTAGATCGATGGTTTGGAGAGCCAGTAAAAGCAGCCGTAATAAGCACTGAATGTTTCATACCAATTTTTCCTCAGCGTTCTACTAACTTGCTAGCGAGTCATGAAGAGCTGATAACAAGATTTTTTCATCATAGTCTACAGGTTATAATATCCGGAAAACCAAATGAAAACACTGAGGGTATGGAGATGCACCCTCATAAACCGTATTTGGACAATCTTCGTAATCTGTTCTGCAAGATGGAACCACTTTCTGAACTCAGCGATCTTTTGGACACACCCTTGAAGGTTATGCCTCTTCATGAGTGGTCTCACTTTAGATTGGTAAACCAGCCACTGAAGGATAATCTAAATGCCCAGATCTTTGAGATGATTGAGGGAGACTCTGTTAAATACAACCCAAGTCCTTATGGTTGTGGGAGCAGGAAGAGGACCCCTTGTGCATTGCAGGCAGCTGAACAAACTGGTCGAAAGTTGAAAGTTTATGCTGTAAAAAAAAATCCCTATGTTGTCATAGCACTCCATGATTTGGTTAAGATGAAAGGATGGGAAGGCATTGTTACCATAATATGTAATGACATGCGTGTCTGGAATGCTCCTGAGAAAGCTGATATATTGGTCACTAGTTACAGTGAATTGCTAGGTTCTTTTGGAGATAATGATCTCTCTCCTGAATGCCTTGATGGAGCCCAAAGGTTTCTGAAGCCAAATGGGATTTCGATACCATCCTCCTGTACAAGTTTCATACAGCCAATTACAACTTCAACACTTTACAATACGCTTAAGGCTCGCTGGAAACCATCCCACTGTGCAGTTGTGTATTTGGTTAATCTGCACACTGTAGCCAAACTTGCTCCTTGTCAACCTGTTTTCACATTTAAGCATCCAAACTCCTCAACAAAGCCCAACAACCAACGATCAACCAAGCTGCGTTTCAATATACCAAAGGAAACAGGTTCTGCTTTAGTTCATGGATTTGCTGGCTATTTTGAAGCTGTGCTTCATGACGACGTGCGTTTTAGCACTGAGCCTACAACAGCAGCACCAGCACAATTGAATTGTAGAGAACTTCAATGTATAGGTTCCATTCATAGAGAGCGAAGCATCAGAATTTTGGCTCTACTCTTCACGATATTCGAAGTCTCCTTCTCCAAGGAATCTCAGATCAGGAGAAAAATTCGGCAAGTGGTAATGGCGGTGCAAGAGGAGCATGAAAAAGCGGTAGTTGAGAGCGACGGGAAGAATGATTCCTCCGTTGTTTCTCCAGCTGCTTCCGGCGACGGGAAAAAGAAGACGAAGAGCAAGGGATTATTCTCGCGGATTTGGAATGCGTTATTTAGGGTTAGAGGTGACGATTTTGAGAAGAGACTTAAAGGAATTTCAAAGGAAGAAGCGACTATTCGGAATCGAATGAAACGCAGATCGATTACAAGGAGAAAGTTTATTAGAAATCTCATCGTTTTCTCTATCTTCTTTGAGATTATTGCAGTGGCTTATGCGATTATGACAACAAGAAATGAAGATTTGGATTGGAAACTGAGGAGTTTCAGGATCTTGCCAATGTTTATTTTACCTGCTCTTGCTTCCCTTCTCTATTCTTCACTCGTGGGCTTCTGGAGGATGTGTGACCGAAGAGATCAAAAAAACTTGGACAAGCTTCAAGCAGAAATGCTGGGAAAGATCAATGAGTTAAAAGAGAGAACGAATTATTACATCACTCAACAACTTATTCAGAAATATGACCCTGACCCTACTGCAAAGGCAGCTGCTGCTACCATCCTGGCATCTAAGTTAGGTGCAGAGTCAGGTTTGAAAGTATTTGTAGGAGATAAATCCCAACTTAACCCCAACGCAGGCAAGAGTAATGACATGGAAACCAAACACCCGCAAGGACTCAGGAACCGAAGACAACCAAATACAAGACGCAACAATGCAGGGACCCATCCAGCACATCACTCCGATAATGAGTCTAACTATTCGGGGACAAGTGAAGTAATCACCTACACAGAGCAAAACCAACAGATGGTGTTTGAGCATTATAATCCTGAGGGAAATGCTGCCCATGATGGTAGCTGGATCTCACGCATTGCAGCTCTCCTTGTAGGCGAAGATCCAACTCAGTCATTTGCACTCATCTGTGGAAACTGCCGTATGCATAACGGACTTGCTCGGAGAGAAGACTTTCCCCACATTACTTACTACTGTCCTCGTTGTGGTGCACTGAACAAGCCGAGACATTCAGAAGAACGTTCACAGTTTGCTCGTGCTGCTACACTGCCTACAGGTTCTATGAAGCCATTGGAAAGCGAAGTGATCAATAGCAGTAGCTCGACTAGCGAACGCGGTGATAGTCCAATCCCTTTGTTAAACACTGCAGATATTGTGGAAGAAGTCCCGGAAAAAGCTGACGGAGAGACACGAAACTGA


· Genomic location:


scaffold384:164329:166384:-