Information for Lmscaffold41.39

· Gene Ontology:


no information


· KEGG information:


no information


· Enzyme Commission number (EC):


no information


· Gene family:


B3/PF02362; Auxin_resp/PF06507


· Interpro information:


Lmscaffold41.39


· Expression data: (root) (FPKM)


2500m3000m3500m4000m


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend
1p6(TAACGG)318321338


· Protein sequence: (703 aa)


>Lmscaffold41.39
MEQEKSLDPQLWHACAGSMVQIPCVNSTVFYFAQGHTEHAHAPPDFHAPPDFHAPRVPPLILCRVVSVKFLADAETDEVFAKITLLPLPENDLDLENDAVLGLTPPSNGNGNGNEKPTSFAKTLTQSDANNGGGFSVPRYCAETIFPRLDYTADPPVQTVIAKDIHGDTWKFRHIYRGTPRRHLLTTGWSTFVNQKKLLAGDSIVFLRSESGDLCVGIRRAKRGGLGSTSLGSDNPYPGFSGFLRDDETTTITTTTKLMMMKRNGGNDGNAASAGKVRVEAVAEAVARAARGKAFEVVYYPRASTPEFCVKAADVRSAMRVRWCSGMRFKMAFETEDSSRISWFMGTVSAVQVADPICWPNSPWRLLQVAWDEPDLLQNVKRVSPWLVELVSNMPAIHLSPFSPRKKIRIPQPFDFPFDGTKFPTFSNNGGGESMCYMSNNDSNTNINNAPAGIQGARQAQQLFGSPSPSLLSDLNLNSYSANKLQYPAMFLNPRHPHYDHIFSHQARNTETSNNISCSLTMGNPAMVQEKNKSVGSFKTHQFLLFGQPILTEQQVMNRKRLLEEEAEAAQNEKVSHGLTWNYGLQGLETGHCKVFMESEDVGRTLDLSVIGSYQELYRKLAEMFHIEERSDLLTHVVYRVANGVIKRIGDEPFSDFMKATKRLTIKMDIGGDNGRKTWITGIRNGENGIDATTKTGPLSIFA


· CDS sequence: (876 bp)


>Lmscaffold41.39
ATGAATAACGGTTCTTGGTTACCTGAAGAAGACTTCAAAGGTCTATCGGATAATTTCTTTGATGATCTCATCGATCATATTGATTTTCCCCTTGAAGACATCGAAACCGTTGATGATGAAGGAGATTGGGATGCGGCTGGGTTTCAAGACCTTGTACCTCCACCATTGGATGTCTTAACCAGTTTTTCCTCTGAGTTCACTTGCAAGGGACGACGTCTCGGAGTCCAGAAGAAACCTGAACCCATTTTGAAGCAGTCAGGCGTCGATAGCTCTTCTCTTGATGTCAAAGTCTCGAAACTGTTTCAGTCTTCAAGCCCAGTTTCAGTTCTTGAGAACACCAATGGTTCTGTCTTGTCCCAGAACCAAAATAGAATTCAGAGACTGGCATTTCCTGTGAAAGGCATTAGAAGCAAGCGCAAACACCCCACCTCTCCAAGATTTGGATTCCTCCAGTCATTTGTATCAGGGATGTGTCAGCAGTTTGTTCCAGATGAATTGGGATCTGAAAGTTACCTCTGCTCTGAGAATTCCACCAAGAAGAAACGCAAGAAGAACAAGAGTCATCCCCCGGCTCACTCGGTCTCTTACAGTCCAGAAGTATTTAACTCAGATGGGACAATCCGAAAATGCACTCATTGTGAGACAACCAAAACCCCACAGTGGAGGGAAGGACCCAAGGGGCCTAAGACCCTCTGCAATGCTTGCGGAGTTCGGTTCAGATCAGGCCGTCTAGTTCCAGAATACCGTCCAGCCTCAAGCCCAACTTTCATCCCAACCAGGCACTCTAATTCTCACAGGAAGATCATCGAGATGAGAAGGAAAGGTGAAGACCAGTTTGATAACGACAGAATCCATGCCGTGACTTCGCAGGCATAG


· Genomic location:


scaffold41:543860:546228:+