Information for Lmscaffold433.296

· Gene Ontology:


GO:0003700


· KEGG information:


K12236: -


· Enzyme Commission number (EC):


no information


· Gene family:


PP2/PF14299; zfNFX1/PF01422


· Interpro information:


Lmscaffold433.296


· Expression data: (root) (FPKM)


2500m3000m3500m4000m


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend


· Protein sequence: (1466 aa)


>Lmscaffold433.296
MNFTVEIARFAGYPFKVVQNHATVVINRAINIFSERGINPQSSLPKTEWFTEAAKSAINRLLMGSDEASEPEDYECEEDDDHIVLPEIKASIGPTLTGTRPGPVFVESRKEMSTQIRRDRRGDRTGFNSQSSQQTWIPRSASTSVVVNVRSVSPNTDRNSESRDAGAASHPVYLQRQHNGSGPPPYNQHQRGNNIGPPNRQRRYNASGTLPDNQHQRSIIGPHPPNQQRRNNVSETQPNNQHQRAVNIGPPQPNRQRRNNVSETLPDSQHQRSISIGPPLPNRQRRNNISEILPDNRQRVASRTRSVDQGKKVAKEENIVLIDPNLPQLVQEIQEKLLKSFIECMICYDKVGRSAHIWSCSSCYSIFHMNCIKRWARAPTSVDLLAEKSQGDNWRCPGCQSVQLTSPKEICYRCFCGKRKDPPSDPYLTPHSCGEPCGKRLEKEFAAAETTKEDICPHVCVLQCHPGPCPPCKAFAPPRSCPCGKKMFTTRCSERRSVLVCGQRCDKHLNCGRHQCERACHVGPCDPCQVLVNATCFCKKNVETVICGDMSVKGELSAEGGVYSCSFDCGKPLGCGNHFCSEICHPGPCGDCDLLPSRVKMCHCGKTRLEEQSRRSCLDPISSCSNICGKLLPCKLHTCSEVCHAGDCPPCLVQVNENCRCGSTSRTVECYITTSLEMEKFVCTKPCGRKKNCGRHRCSERCCPLLNVKKNDLSGDWDPHICQIPCGKKLRCGQHSCESLCHSGHCPPCLEMIFTDLTCACGRTSIPPPQPCGTPVPSCQLLCSIPQPCGHSATHGCHFGDCPPCSAPAEKKCVGGHVVLRNIPCGLKDIRCNKICGKTRRCGMHACARTCHSEPCDNYNDSETGLRVTCGQTCGAPRRDCRHTCSALCHPSAPCPDLRCEFPVTITCSCGRITATVPCDAGGRNANGSYVDSAYDEASVLKKLPAPLQPVGLSGNQIPLGQRKLSCDDECAKLERKRVLQDAFDITTPNLEALHFSENSAMTEIISDLYRRDPKWVMAVEERCKFLVLGKARGSPSALKVHVFCPMQKDKRETVRLIAERWKLAVSNAGWEPKRFTMVHVTPKSKPPTRIIGARGGVSVGGPHPPSFDPLVDMDPGLVVSLLDLPREANISALVLRFGGECELVWLNDKNALAVFHDHARAATAMRRLDHGSVYHGAVVVQNSVQNPSLSNAWGKLPGGSSWGGQKGNPWKKAVIQETDDSWGAEDSPIKESSTAWRSVENITPIATSVNRWSVLEPEKAITPTVAILSQTEEGSSSKAAGKQPVEGSGEEVVDDWEKIVRKAWVFKPSGLKFIWGGDSRYWVIPKEDRTPAELKKVSWLEVTGAYDNIEPGKTYRIGFNISFTADATGWDQAPVFMSAKIGKKGKTAWKRIKSINNNIEKLKGGTGPVNIPDETDGRFEVFISPKVPIDQDTKLQFGLYEVWTGKWKTGLLIYEAFVEEVLTDL


· CDS sequence: (966 bp)


>Lmscaffold433.296
ATGGAACACGAGTTGGTTGAATTACGGAAACATATTTCTTCTCAGGGGATTCTTGTGCAGGACCTGATGGCTGGAGTTTACCGTGAGATGGATGATTGGAAACGATCCTCGGGTGATGTGGATGACACTGAAGTTGAGGAGGACCCCTTTCCTAAGGAACAAACCGATCCAAAGTCTGAATTTCTAGAGAAAGTTGACCTTCTCTTGGCTGAACATAAAGTGGATGAAGCAATGGATGCTGAGGAAAGAAAAAGCCCAAATCTTAAAGGATCAGTCGAGTTGTCCTCTTACAAATCTGCTTTTATTGAGAAAAAGGCGGTTCTTGAGGATCAACTTCTTAGGATTGCTAAACAACCTTCGATTAATGTAGCTGAATTAAAGCATGCATTAATTGGGCTGATCAGACTTGGAATTGGACCTTCAGCTCACCAATTGCTTCTGAAGTTTTACGCTACAAGCCACCGTCGAAGAATCGAGGCCTTGGCTGCCAAAGAATCTGCAGCATTGTTCGGTGATGATGATTATTCCGCATATTCCAACAAAGTTGTTCAATGGGCAGAAAGGGAAGTTGAGTATTTGGTGCGTTTGGTTAAAGAAAACGCTTCTCCTTCTGAAACGGTTTCTGCATTGCGTGCAGCCAGTGTATGTCTTCAAGACTGTCTCAACTACTATACTACAATGACTGATTGCAGCATTCGATTCATGCAAATTGTGCAAGATATACTTGAGCAGTTAACGCATTTAGTTGTGTTACACTTTGGTGAAAGTGTATTAACAAGGATATTGCAGTTATATGATAAATACATCGACTTTCTAATCAAAGCCTTGCCTGGTCAATCAGATGAAGATGGTCTCCCAGAGCTCCAAGATAGTACCACATTCGCTAGAGCTGAAACAGATTCAGAGCAGCTTGTTCTACTTGGAGCGGCGTTTACAATCCTCGATGAACTTTTACCATTACACTAG


· Genomic location:


scaffold433:1919974:1926520:+