Information for Lmscaffold550.84

· Gene Ontology:


no information


· KEGG information:


K14486: K14486, ARF; auxin response factor


· Enzyme Commission number (EC):


no information


· Gene family:


B3/PF02362; AUX_IAA/PF02309; Auxin_resp/PF06507


· Interpro information:


Lmscaffold550.84


· Expression data: (root) (FPKM)


2500m3000m3500m4000m


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend


· Protein sequence: (603 aa)


>Lmscaffold550.84
MEQSSEVLNAHPELNIIDDTNYLYQKLWNLCAGPLCNLPKVGEKVYYFPQGHIELIEKYTREDFTHMKPYFDLPSKLRCCVTHIQLKVEKETDEVYAKVSLIPDTNQIIIPNSNGDQQQPIMNSCMKILTTSDTTTNGGLFVPIKHAIECLPPLDMSMPIPSQDLIAKDLHGHNWSFKHIYRGTPKRHLLTTGWSAFVTSKKLVAGDSIVFIKGDNELRVGIKRSNLQQENIHSSVISAQCMHNGVIASAMNAFTNKCIFVVIYRPKTSQFVVSYDKVKDAMNNKFNIGMRFRMWFEAEDFSPKCYFGTILGIYNFSPHWKDSEWRSLEVQWDESVLFSRPNNVSPWEIELLIHLSNAPQSAMLTKKRYRQVNNKVSSSLNIWTPTLTMEQEIGQSSMNCMIPTIPKSNDMNNQMVQSMKEKIANDTTNRCILFGVDLATPSKTKDTMKQVQLYQKSDISKFSEEKKLNHTQTLTSPKEVQSNHFISTRNCTKVQMQGVPIGRAVDLTVLHGYDQLKQELEKLFDLKGELQTRNQWEIVFTDHEGDTMLVGDASWLEFCKMVKKIFIYSKKSVSETKSENKFFQVESGVLTSSDTLSDLNIDN


· CDS sequence: (2073 bp)


>Lmscaffold550.84
ATGCTATCCTCAGTGTTTGTTGGAAATGGTTGGAAGGCTTTAATTCCAGTAGTTATGTTCTGCAGAGGTCATGGTTCTGAAGCGTGGAATACTTTGTCCAAGGATATAAGACGAATTCCTATATTAAAAGATGATGGCTTCAGTGATATGGTTGAGATCTCTGAGTATTTTAGTTGGGGCTTTGTTTATAGTATTGCTGAGGAAACTTGTTGTGTGGACAAAGAATTGGTGAGAGCCAAATTGTGTACTGATCTCCATGAACTAGCTGCCAGCAATCCTTCTCTATGTGACAAACTCGATTTTCCGAGGGTGAATCAATTTGCACTAGTGTCACTTATCTCCTTCATTTGTCGAAATCGTAGTGGGGGAATGGAAGGTTTAAAGGAAGATCTCATTTGGTTAATCCTTCAATTTCTGTGTGAAGAGAAGTACAAGAACACTTGGCATAAATTAGAGCAAGAAACAAAAGTCTTCTTCAATTTAGATTATCTGGTGGAAGTGATGACGCTTGGTGAATTGGACAAAGCTGAAGGGTACTTGGCAGATTTTACAGGCAAACACGAGAATAAGTACTCAGAAGCTATGTTTCTTGAAATTCAGAAACTTAAATGTCTAGAATCTACAAAATGGGAGGTTACAACCCTATCTGGATCTCCTGATAACATGTCCCTGAAAAAAAAGTTACATGTCTCTGTTGCCATGCTAGCCAAAAAGAATCCAGCACTGCAAGATAAACTCAAGCTTCCTAGCATGGAAAAGTCAAGACTTTTAAGACTGATGAAGCAGAGTGTGGACTGGTGGATTCCTCATAACGTCAAAAATCTTAGATCTCTGGAAAATATTCCAGTAGTAGCATACCTTTGTGGCACACCATCATCCCCTTTGAGAAAGAAATTTAATAAAACAGTGTCAAGGAGAAAGGTTTTTAACTGCAAACTAAGGGAAATCACTGATCCATCCGAATGCAATGCACTTGTTCTTCCAGATTATTTCTCAGAAGAAAAGATTGCATGTTTGACCTACTCCACTTCTGGAGACTATATACTGGCTTTGGCAGAAGACGGCACACATAAACTCTGGACATGGTCGAGTAGCCAAAATGAATTCTGCAAGGATACTCCTCTAATATTGAGGGAAAATGTATTTCCAAAGCCACGATTACACCAACCTGAGAGTGGGAATACTATGAGAAACGAGATAGCAACCTGTGTTCAGAATCTAACGTCATGCTTTGCGATCAAGGGTTCCCATCTTTTTTCTACTTCAGGAGGAAAAATAGCAGTTTTTGATCTGATGAGTTTTAAGAAAGTAGCTGCTTTTGGAAGTCCTGCACCTATGGCTACGTATTTTATATTTATCCCTGGTGATTTGCTTGCTGTTGGTCTAGATGATGGTTCTATCTTTATTCATTGTTTATTGTCGAGAAAGGTCAAAGAAAAGCTGGAGGGCCACGATCATAGAATAACCTGCCTAGCATTTTCACACTTTTTTAATGCCCTCGTCTCTTCAGGAGCTGATGGAAAGCTCTGTGTTTGGAGCACAAAAAGCTGGGCAAATATAGCAAAAAATAAGCCCACACTTAAAATTTGCAGCCGGCATACACATGAGTCCTCCTCTGTAGTAACTAACATACAGTTTGACCCGTATCAAATCGAGCTACTTGTGGTGGGTGAGGGGTGGATAGGTGTATATGAAGCTAGGACTCTTGGTTGCCTTATGCAGTGGGTACCTGATGTATCTGATGCTTCAATAACTTCTGCTACATATTCTTCCGATGGTGAGATGATATATGTTGGTTTTAGAAGTGGGTCTATAAAAGTTTTGGACTCCAAGACTTTGGTGACAATATGTCGAATCAATCTGACTGCTATTTCTCAACCCATCCCCAGCAACAGGCTCGAGGTTTATCCGACTGTGGTAGTTGCTCATCCTTCACATCTAAGTCAGATATCTGTTGGGCTCAATAATGGTAAGGTTATTGTTCTTCAGCCACTGGAAGGGAGAGGATGGGCTGAAGAAGCTCGACATGAAGAAAATGAAGATCATTCTGACGACTCAGATCATTGTTACTGA


· Genomic location:


scaffold550:1141903:1145289:+