Information for Lmscaffold60.81

· Gene Ontology:


GO:0003700 GO:0005667 GO:0007049


· KEGG information:


K04683: TFDP1; transcription factor Dp-1


· Enzyme Commission number (EC):


no information


· Gene family:


E2F_TDP/PF02319; DP/PF08781


· Interpro information:


Lmscaffold60.81


· Expression data: (root) (FPKM)


2500m3000m3500m4000m


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend
1p3(AAG)618265282


· Protein sequence: (384 aa)


>Lmscaffold60.81
MTTTGSNSNHNHHDDGFGKNNNNNPISRSWGTEISGQSVSTSGSMGSPSSRSEQTTTVGTSASDSTFLRLNNLDIQGDDAGSQGASGGKKKKKKGQRAAGPDKSGRGLRQFSMKVCEKVESKGRTTYNEVADELVAEYALPNNDGTSPDQQQYDEKNIRRRVYDALNVLMAMDIISKDKKEIQWKGLPRTSLSYIEELKNERLSLRNRIDKKTAYAQELEEQYVGLQNLIQRNEHLYSSGNAPSGGVALPFILVQTRPHATVEVEISEDMQLVHFDFNSTPFELHDDNFVLKTMKFCDQPPQSNGHNNSQVSSHSFVPEVQNEGPSTGPAREPDMYQSNHPQPPQRQLHFQPQIIPMPETNDIASAADTSPVTSLIKNHVKPEN


· CDS sequence: (333 bp)


>Lmscaffold60.81
ATGTGGAGATATGGAGAAGGCGAAGGAGATGATGATGAAGATGAAGATGAAAAAGGAGATAAGGACAAAGAGGAGAAATTAGATGATAATATAATCATTCACCAAATTGCTGAGAAGGGTTTCGTTAACATGTTGTATTTAGGGAACTTGGATTACTCAATATCAAAATTCAAGGATTTTCTTGTGGCTTTGTTTAATTTGTGGCATTTTGATACTGCTGATGGTAGTATTGCCAAGTTATATATTGCGCCAGTATCAAAGGTAGCAACCGAAGACGATGTAAGTGTCTTGGCTTACTCTTTATGGTTTATGAGATGTTTCCTTAGATTCTGA


· Genomic location:


scaffold60:363114:365478:+