Information for Lmscaffold668.187

· Gene Ontology:


no information


· KEGG information:


no information


· Enzyme Commission number (EC):


no information


· Gene family:


E2F_TDP/PF02319; AMPK1_CBM/PF16561; DP/PF08781


· Interpro information:


Lmscaffold668.187


· Expression data: (root) (FPKM)


2500m3000m3500m4000m


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend
1p3(ATC)61812141231


· Protein sequence: (975 aa)


>Lmscaffold668.187
MTTTGSNSNHTHHDYGFGKNNNNPITRSWGTAISGQSVSTSGSMGSPSSRSEQTTTVATSASDSTFLRLNNLDIQGDDAGSQGASGGKKKKRGQRAAGPDKSGRGLRQFSMKVCEKVESKGRTTYNEVADELVAEFALPNNDGTSPDQQQYDEKNIRRRVYDALNVLMAMDIISKDKKEIQWKGLPRTSLSDIEELKNERLSLRNRFDKKTAYAQELEEQYVGLQNLIQRNEHLYSSGNAPSGGVALPFILVQTRPHATVEVEISEDMQLVHFDFNSTPFELHDDNFVLKTMKFCDQPPQSNGHNNSQISSHSFVPEVQNECPSTGPASQPDLYQSNYLQPPQRQLHSQPQIIPTPETNDIASAADTAPVTSPHLPDSSAMATISHIPFSLSFPSFEFRKPLFYYHHHHHQQPPHFVSYLNSTKKHCFICFAYSIKQTRVRKKVKSNEELRSEIMEFVSLAGLPQGHVPSMKELSAHGRVDLANIVRRRGYKFVKELLANSNLEDCNELVSEKSTNMDSSASGVSLEHSLTEGQGEGVRDVVDENLSTVHGSVNKDELSLTGVLSSENSFSNLGDSNQSGEITENTLKIERVELNNRPDVDNSSSEAIISASHSLVLDDFSLTYDHYTSPTNDHYTSPTNDHYTSPTNDHYTSPTNDHYTSPTYNHYTSPDLSYTKRVDIATESLSADMAENRYGSGDDSLVESESNGWMFGLSSSTSSIEERTTRFIQSGYLDTVDDEINHESDPEEAKESVETTKSDEYIGDSYGGQRSLSTPSNGSALTLEEVTHVTEVNSFNSNSGQRDGSDDLDTDPHDETRKQENQVEITRLRSMLHQKELELSRLKEQIEKEKLSLLVLQRQAETEIHKAQMLILEKDAELQEVEENLSGLQEVVIEYCGDGNVVEVTGSFNGWQHRVGMELQASKSIGEHKCWSTLLWLYPGTYEIKFIVDGQWITDPQRDSVTKGHITNNILKVVR


· CDS sequence: (1458 bp)


>Lmscaffold668.187
ATGAGAGCAATTCACATTGTGACGACGAGGTTGAGTTCAAGTTTTAGGCCTATTTTGCTTGATTTGGTTTCTTATTCGCCTCCTCGAGAGTTCTCTATCAGTAGGCGTCTTATTTGTGCCGCGACGAAGGCTAATGGAGGAGGCAGGTCTGGTTCAATTGTGGCTCCATTGGTGACTGAAGATTTTCAGAAGATTGATGTCAATCCACCTAAAGGAACTCGTGATTTCCCTCCTGAGGATATGAGACTTCGAAACTGGCTTTTCAACCATTTCAAAGAGGTCTCACGGTTATTTGGGTACGAGGAAGTGGATTTTCCAGTTCTGGAGACGGAGGCATTGTTCATCAGAAAAGCAGGGGAGGAGATTAGAGATCAACTTTACTGCTTTGAAGATAGGGGTAATCGGCGTGTAGCATTGAGGCCTGAGCTTACACCTTCTTTAGCGAGGCTTGTGATACAGAAAGGAAAATCCGTTTCACTTCCTTTGAAGTGGTTTGCTGTTGGGCAGTGTTGGCGCTATGAGAGAATGACACGAGGAAGGCGACGCGAGCATTACCAGTGGAATATGGATATAATAGGTGTGCCTGAAGTAACAGCTGAAGCAGAATTAATTTCATCTATAATCACCTTCTTCAAGCGAATTGGGATCACTGCATCAGATGTTGGTTTTAAGGTTTCAAGCCGCAAGGTTTTACAAGAACTGTTAAAAAAGTATGGTGTACCTGAAAACCTGTTTGGAAGAGTTTGTGTCATTATAGATAAGGTTAATAAAAAGATCCCAGTTGATGAGATAAAAAAGGAACTTGGGTTGACGGGAATATCAGAAGATGCTATTGAACAGTTATTGCAAGTGCTTTCTGTCAAGTCCTTAGATGATTTGGAAGGTATACTTGGTGGAGCAGGAGAAGCTATTGCAGATTTGAAGCAACTCTTCTCACTTGCTGAAAAGTATGGCTATTCAGAGTGGATACAGTTTGATGCATCTGTTGTGCGTGGTCTTGCTTATTACACTGGTATCGTCTTTGAGGGATTTGATCGAAAAGGGAAGCTACGAGCTATATGTGGTGGTGGGAGATACGACAGATTACTCTCCACTTATGGAGGTGATGACATTCCGGCTTGTGGTTTTGGTTTCGGTGATGCTGTAATTGTTGAATTGCTTAAGGAGAAGGATTTGTTGCCAGAACTGGGACAAGATGTAGAGAACATTGTCTGTGCTTTGGACAAAGATCATCAAGGAGCTGCAGCCACCGTTGCAACCACTCTCAGAAACAAAGGCCAAACCGTTGATTTGGTATTGGAAAGTAAACCTTTGAAATGGGTGTTCAAAAGGGCGGCTCGAGTAAACGCAAGAAGGCTGGTTCTAGTTGGGAAACAAGAGTGGGAAGATGGTTCGGTCAGTGTGAAGGTTATGTCTACAGGTGAGCAGTTCCAAGTCAAACTTAATGACTTAGAGTAA


· Genomic location:


scaffold668:919146:925305:+