Information for Lmscaffold785.27

· Gene Ontology:


no information


· KEGG information:


K14432: ABF; ABA responsive element binding factor


· Enzyme Commission number (EC):


no information


· Gene family:


p450/PF00067; PPR_1/PF12854; CDC73_N/PF16050; CDC73_C/PF05179; WGG/PF10273; bZIP_2/PF07716; PPR/PF01535; Prefoldin_2/PF01920; PPR_3/PF13812; zfFLZ/PF04570; bZIP_1/PF00170; PPR_2/PF13041; SMP/PF04927; PPR_long/PF17177


· Interpro information:


Lmscaffold785.27


· Expression data: (root) (FPKM)


2500m3000m3500m4000m


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend


· Protein sequence: (432 aa)


>Lmscaffold785.27
MGTHINFNNLGGGGPPGGEESNQMKPTSSVMPLARQSSVYSLTFDELQSTLGGPGKDFGSINMDELLKSIWTAEEAQAMAMTSSSTAAVAQPGAAIPGGNLQRQGSLTLPRTISQKTVDEVWKCLITKDSNNGNMGGSSGGGGESNAPPGRQQTLGEMTLEEFLFRAGVVREDNCTQQMDQGNGNNNNGFYGNNGAASGIGFGFGQPNQNSISFNGNSDSMILNQPPGLGLKVGGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXQTIFPKQANVAFTPPVSMVNKSFAGAANNAINNNNGISSFGGAGVTVAATSPGTSSADNNSLSPVPYVLNRGRRSNTGIEKVIERRQRRMIKNRESAARSRARKQAYTLELEAEIEKLKKVNQELQKKQAEMMEMQKNELKESSKRPWGSKRQCLRRTLTGPW


· CDS sequence: (978 bp)


>Lmscaffold785.27
ATGACTTCAGGGACTCCTCGAATCGCCAAAGATGTCACTGAATTGATAGGGAACACTCCATTAGTCTATCTGAACAAAGTGACTAAAGGTTGTGTTGGCCATGTTGCTGCTAAGCTCGAGATGATGGAACCATGTTCGAGTGTCAAAGACAGGATTGGTTATAGCATGATTTCTGATGCAGAAGCTAAGGGTCTTATAAAACCAGGAGAGAGTGTGTTAATCGAGCCAACAAGTGGAAATACTGGTGTTGGATTAGCATTCACAGCAGCTGCAAAGGGATACAAGCTTGTTATTACAATGCCAGCTTCAATGAGCATAGAGAGAAGAATTATTCTCTTAGCTTTTGGAGCTGAGTTGGTTCTCACTGACCCAGCCAAAGGCATGAAAGGCGCTGTTGCAAAGGCAGAGGAGATTTTGGCTAAAACACCTAATGGTTACATGCTCCAACAATTTGAGAACCCGGCTAACCCAAAGATCCACTATGAGACTACTGGACCTGAGATATGGAAAGGTTCTGATAGAAAAATCGATGGCTTTGTTTCTGGTATTGGTACTGGTGGTACCTTAACAGGTGCTGGGAAGTATCTCAAGGAACAGAACCCAAACATAAAGCTGTATGGTGTCGAGCCCGTTGAAAGTCCTATTCTGTCCGGTGGAAAGCCAGGCCCACACAAAATTCAAGGAATAGGTGCTGGTTTTGTTCCAGGCATTTTGGATGTTGATCTTATAGATGAAGTTGTTCAGGTTTCAAGTGAAGAATCAATTGACATGGCAAGGTTTCTTGCTCGGGAAGAGGGTCTGTTGGTAGGAATTTCATCTGGAGCAGCAGCTGCCGCAGCAATCAAACTTGCAAAGAAGCCAGAAAATGCGGGGAAGCTTATAGTGGCGGTGTTCCCGAGTTTTGGGGAAAGATATCTATCGACTGTACTGTTTGATGCGACAAGGAAAGAGGCAGAAACAATGACCTTTGAGCCTTGA


· Genomic location:


scaffold785:162158:164024:-