Information for Lmscaffold802.11

· Gene Ontology:


no information


· KEGG information:


no information


· Enzyme Commission number (EC):


no information


· Gene family:


Helicase_C/PF00271; AAA_30/PF13604; DUF1264/PF06884; SNF2_N/PF00176; AAA_19/PF13245; ResIII/PF04851; SMP_LBD/PF17047; bZIP_2/PF07716; AAA_12/PF13087; UDPGT/PF00201; AAA_11/PF13086; bZIP_1/PF00170; Exo_endo_phos/PF03372; C2/PF00168


· Interpro information:


Lmscaffold802.11


· Expression data: (root) (FPKM)


2500m3000m3500m4000m


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend


· Protein sequence: (335 aa)


>Lmscaffold802.11
MEKSEIPPNPITNVPSDPIPHPNPNADSIPGSSFHRRSRSDDMSMFMFRDPLAGAQPFSEDLPSDDDLFSSFIDVDSLSSNPNPFPNPSLSSNSGSGATPQLSSSRPRHRHSNSVDAGCAMYAGEILDAKKAMPPEKLSELWNIDPKRAKRILANRQSAARSKERKARYIQELERKVQSLQTEATTLSAQLTLYQRDTNGLANENTELKLRLQAMEQQAQLRNALNEALRKEVERMKMETGEISDNSDSFDMGLQQIQYSSSTFMAMPPYHGGLMNNGQDMQMQSFNPMEISNSQSVSDFLQNGRLQGLEISSNSSRLVKSEGPSLSASESSSAY


· CDS sequence: (5853 bp)


>Lmscaffold802.11
ATGGCTCAAAGAAGGGAACCTGATCCGCCTCCGCCACAGAGGCGGATTCTCCGGACTCAGACTGTTGGTAGTCTGGGAGAGGCTATGCTTGATAGTGAAGTGGTGCCATCTTCTTTAGTGGAGATTGCTCCAATTCTTCGTGTGGCCAATGAAGTTGAAGCTAGTAATCCACGAGTTGCTTACTTATGTCGTTTTTATGCATTTGAAAAGGCGCATAGGCTTGATCCAACATCAAGTGGACGTGGTGTTCGACAGTTTAAGACTGCTCTTCTTCAACGATTAGAAAGGGAGAACGAAACAACTTTGGCAGGAAGGCAAAAGAGTGATGCGCGTGAAATGCAGAGTTTCTATCAACACTATTACAAGAAATACATCCAAGCTTTGCTAAATGCTGCTGATAAAGCTGACCGTGCTCAACTTACAAAGGCCTATCAAACTGCTGCCGTTCTCTTTGAAGTCTTAAAGGCTGTTAATCAGACAGAACATGTGGAAGTGGCTGATGAGATTTTGGAAACGCACAATAAGGTGGAAGAGAAAACCCAGATCTACGTTCCTTACAATATACTTCCCCTTGACCCTGATAGTCAGAATCAGGCTATAATGAGATTGCCTGAGATACAAGCTGCTGTAGTCGCTCTTAGAAATACAAGGGGTTTAGCGTGGGCAGCAGGTCACAAGAAGAAACTCGATGAAGACATTCTAGACTGGCTTCAGTCTATGTTTGGTTTTCAGAAAGATAATGTTTCGAACCAAAGAGAGCACTTGATCTTATTACTTGCTAATGTCCACATTCGACAATTTCCTAGACCTGAACAACAACCAAAGTTGGATGATCGTGCCTTGACCATAGTGATGAAGAAACTTTTCAGAAACTACAAAAAGTGGTGCAAGTATTTGGGTCGGAAAAGCAGCCTTTGGTTGCCGACTATTCAACAAGAGGTACAACAGCGTAAATTGCTCTACATGGGACTTTACCTTTTAATATGGGGGGAAGCTGCAAACCTGAGATTCATGCCAGAATGCCTCTGTTATATATATCACCATATGGCTTTCGAGTTGTATGGTATGTTGGCTGGTAGTGTTAGTTCATTGACAGGGGAGCATGTAAAGCCAGCTTATGGTGGTGAGGAGGAAGCTTTCCTGCAGAAAGTAGTGACTCCTATATACCAGACAATAGCAAAGGAAGCAAAGAGGAGTAGAGGAGGAAAATCAAAGCATTCTGTGTGGAGGAACTATGATGACTTGAATGAATATTTTTGGTCAATTCGTTGTTTTCGCTTGGGGTGGCCTATGCGAGCTGATGCTGATTTCTTTTGTCACACAGCTGAAGAACTTCGACTTGAGAGAAGTGAGATAAAATCAGATAGCGGAGATCGGTGGATGGGCAAAGTTAATTTTGTTGAGATACGCTCATTCTGGCATATATTTAGAAGTTTCGATAGAATGTGGAGCTTTTATATCTTGTCTTTGCAGGCAATGATTGTTATTGCATGGAATGGATCCGGAGAGTTGAGCTCCATCTTTCAGGGTGATGTCTTCCTAAAGGTCTTGAGCATCTTCATTACAGCGGCTATACTAAAGCTTGCACAAGCTGTCCTTGACATAGGCCTCAGCTGGAAAGCTAGACATAGCATGTCACTTCATGTAAAACTCAGATACGTGTTGAAGGTTATTGCAGCTGCTGTATGGGTAGTAGTCATGCCAGTTACTTATGCGTACAGCTGGAAAGACAAAGACGCTTCTGGTTTTGCACTGACCTTAAAGAATTGGTTTGGGGGAAACAGCCATAATTCACCTTTCCTATTCATAGTGTCGATTCTTATCTACTTATCCCCCAACATGCTTTCTGCCTTGCTATTTTTGTTTCCATTCGTTCGGCGTTATCTTGAAAGGTCTAATTTCAAGATAATGATGCTGATGATGTGGTGGTCTCAGCCTCGGCTGTATATAGGAAGGGGTATGCATGAGAGCACGTTGTCACTTTTCAAGTACACAATGTTTTGGATTGTTCTGCTGATTTCAAAGCTAGCATTCAGTTATTACGCCGAGATTAAGCCACTTGTTGGTCCAACCAAAGATATAATGCGAATCCATATTTCCGCCTACAGCTGGCATGAGTTTTTCCCTCATGCCAAAAGTAATATAGGCGTTGTTATTGCGCTCTGGTCACCAGTTATTCTCGTTTATTTCATGGACACTCAAATATGGTATGCTATAGTTTCAACTCTGGTTGGAGGTTTAAATGGAGCTTTTCGTCGTCTTGGAGAGATCCGAACACTTGGAATGTTAAGGTCGAGATTTCAGTCCATACCAGGGGCATTTAATGATTGCTTAGTGCCACATGATAAGAGCGATGATACAAGGAAAAAGGGATTTAGGGCAACCTTCTCACGCAGATTTGATCCGCTCCCGTCCAGCAAAGACAAGGAAGCAGCGCGGTTTGCTCAGATGTGGAACAAGATAATTAGTAGCTTCCGAGAGGAGGACTTGATTAGTGATAGGGAAATGGAACTTTTGCTTGTGCCATATTGGTCTGACCCTGACCTGGATCTTATTCGGTGGCCACCTTTTCTACTGGCTAGTAAGATCCCAATAGCTTTGGATATGGCAAAAGACAGCAATGGAAAAGACGGTGAACTGAAAAAGAGATTGACTGTTGACAGCTACATGACTTGTGCAGTTAACGAGTGCTATGCCTCTTTTAAGAATCTAATTAATTTTTTGGTCCTCGGAGAACGAGAACGACAGGTCATAAAGGATATTTTCTCCAAAATTGATGAATATATTCAGAAAGAGACACTGACCACAGAACTTAACCTGAGTGCTCTTCCTGATCTATATGGCCAGTTTGTTCGGCTAATCGAATATTTGCTGCAAAACAGGGAAGAGGACAAGGATCAAATTGTAATTGTCTTGCTGAATATGTTAGAAGTGGTTACTAGAGACATAATGGAAGACGAAGTCCAGAGCTTACTAGAGACTGCCCACAATGGATCCTATGTCAAGTACGACGTCATGACCCCTCTTCATCAACAGCGAAAATATTTCAGCCAACTTCAATTTCCAGTTTACTCTCAAACAGAAGCCTGGAAAGAAAAAGCAACTATGGATGTTCCGTCCAACTTGGAAGCCCGAAGGCGTCTTACTTTCTTTTCAAATTCTTTATTCATGGACATGCCTGCTGCACCTAAAATCCGCAACATGCTTTCCTTCTCGGTCCTAACACCATACTTTTCAGAGGATGTTCTTTTCTCCATATTTGGCCTCGAACAGCAAAATGAAGATGGAGTCTCTATACTTTTTTACTTGCAGAAGATCTTTCCAGATGAATGGACAAATTTTCTGGAACGAATTAAATGTGGCAGTGAAGAAGAATTAAGAGCAAGAGAGGATTTGGAAGAGGAACTTCGTCTTTGGGCATCTTACAGAGGCCAAACTCTGACCAAAACTGTGCGAGGCATGATGTATTACCGAAAAGCTTTGGAACTTCAGGCCTTCCTTGATATGGCAAAGGATGAAGAATTATTGAAAGGCTACAAAGCTCTGGAGTTAACCAGTGAAGAAGCTTCAAAGAGTGGAGGGTCACTCTGGGCACAGTGTCAAGCACTTGCAGATATGAAATTTACCTTTGTGGTTTCTTGTCAACAATACAGTATTCATAAGAGATCTGGTGACCAACGCGCTAAAGACATATTAAGACTAATGACAACGTATCCGTCTATTCGTGTTGCATATATTGACGAGGTGGAGCAAACACATAAAGTCAGTTACAAGGGGACAGAAGAAAAGATTTATTATTCAGCCCTAGTGAAAGCGGCTCCACAGACTAAACCAATGGACTCTTCTGAGTCTGTTCAAACACTAGATCAGCTCATTTATCGGATTAAGCTTCCAGGACCAGCTATACTAGGAGAGGGAAAACCGGAAAATCAGAACCATGCTATCATTTTTACACGTGGTGAAGGGTTGCAGACAATAGACATGAACCAGGATAACTACATGGAGGAGGCTTTCAAAATGAGGAACTTGCTGCAAGAGTTTCTTGAAAAGCATGGAGGCGTGAGAAATCCTACGATTCTTGGTCTTAGAGAACATATTTTCACAGGAAGTGTTTCTTCTCTTGCATGGTTTATGTCAAATCAGGAGAACAGCTTTGTCACGATTGGGCAAAGGGTGCTAGCTAGTCCCTTGAAAGTACGATTTCATTACGGCCATCCAGATGTTTTTGATCGTCTATTTCACCTTACCAGAGGTGGTATCTGCAAAGCTTCTAAAGTCATTAATCTTAGTGAAGACATATTTGCAGGCACTTCCATGATCTCAATCTTCTCTGTGGGTTTTAATTCTACTCTGCGTGAAGGAAATGTGACACATCATGAATATATTCAAGTTGGTAAAGGGAGAGATGTGGGCCTCAACCAGATTTCAATGTTTGAGGCAAAAATTGCCAATGGAAATGGCGAGCAAACTTTAAGCCGAGACTTGTATAGACTGGGACACCGATTTGATTTCTTCCGAATGCTGTCTTGTTATTTCACCACAATTGGCTTCTACTTCAGTACTATGTTAACCGTGCTTACGGTGTATGTGTTTCTTTACGGTCGGCTATATCTAGTACTTAGTGGGCTTGAACAAGGATTGAGCAACCAGCGAGCTTTTCGCAATAACAAACCTCTTGAGGCAGCTCTTGCTTCTCAATCATTTGTGCAGATTGGTTTTTTGATGGCTTTGCCTATGATGATGGAGATTGGACTTGAGAGGGGGTTCCACAATGCATTGATTGATTTTGTGCTGATGCAGTTGCAACTTGCTTCAGTCTTTTTCACGTTTCAACTCGGAACAAAAACACATTACTACGGAAGGACATTGTTTCATGGAGGCGCAGAATACAGAGGAACTGGTCGTGGGTTTGTGGTGTTCCATGCCAAATTTGCTGAAAACTATAGGTTCTATTCCCGTAGTCACTTCGTGAAGGGTATCGAGCTAATGATGCTCCTACTCGTGTATCAGATATTTGGCCAATCATACAGGGGTGTGGTTACTTATATTCTGATCACTGTTTCTATATGGTTTATGGTGGTGACGTGGCTCTTTGCTCCTTTCTTATTCAACCCGTCTGGTTTCGAGTGGCAAAAGATTGTTGATGACTGGACAGACTGGAACAAATGGATATATAACCGAGGAGGAATCGGTGTCCCTCCTGAGAAAAGCTGGGAGTCTTGGTGGGAGAAAGAAATAGAACATCTTAAACACTCGGGGATCCGCGGTACCATCCTTGAGATTATTTTAGCATTGAGGTTCTTCATCTTTCAGTACGGACTTGTGTATCATCTCAGTACCTTTAAAGGGAAAAATCAAAGCGTTTGGGTTTATGGAGCATCATGGTTTGTGATCTTATTCATTCTACTTATTGTGAAGGGTTTGGGCGTTGGAAGGCGAAGATTCAGCACGACTTTCCAGCTTCTATTCAGAATCATAAAGGGTCTTGTGTTTCTTACATTTTTGGCAGTTTTAATAACTTTCCTCGCACTTCCTCTGATAACAGTTAAAGACCTATTCACCTGCATGCTTGCCTTCATGCCAACGGGATGGGGAATGCTTCTTATTGCACAAGCTTGTAAGCCTGTTATCCAACGGTTAGGGATATGGTCATCGGTTAGGACGCTGGCTCGGGGCTACGAGATCGTTATGGGCCTGCTTCTTTTCACCCCAGTTGCTTTTTTGGCTTGGTTTCCATTCGTGTCCGAGTTCCAGACAAGAATGCTCTTTAACCAAGCTTTTAGTAGAGGTCTCCAAATCTCTCGTATACTTGGTGGTCAAAGGAAAGACCGATCTTCCAAAAACAAGGAGTGA


· Genomic location:


scaffold802:41768:43172:-