Information for Lmscaffold98.737

· Gene Ontology:


GO:0003700


· KEGG information:


K15683: -


· Enzyme Commission number (EC):


no information


· Gene family:


zfNFX1/PF01422


· Interpro information:


Lmscaffold98.737


· Expression data: (root) (FPKM)


2500m3000m3500m4000m


· Simple Sequence Repeat (SSR) data:


SSR nr.SSR typeSSRsizestartend


· Protein sequence: (517 aa)


>Lmscaffold98.737
MAGSVVTEFRWKSPPQNKNVFSVSDSDSENHQHRHNDLSNSIFKAYLDCHSSSSPSSIDLAKIQSFLASSSSGASLARQYLDLQAARAVTRPSSNATEPEAVWNCPKCRSSYKKSEIPRRYLCYCNKEEDPPADNPWILPHSCGEVCERPLSNNCGHCCLLLCHPGPCASCPKLVKAKCFCGGVEDVRRCGHKQLSCGDVCERLLDCDIRKCREICHDDKCPPCRERAVYKCCCGKVKEEKDCCERVFRCEAPCENMLNCGKHVCERGCHSGECGLCPYQGKRICPCGKRFYQGLSCDVSAPLCGGTCDNLLGCGYHRCPERCHRGPCLETCRIVVTKSCRCRGTKKQVPCHQEVACERKCQRVRDCGRHACRRRCCDGDPPCSEICGKKLRCRNHKCQSPCHQGPCAPCPVMVAISCACGGTHFEVPCGTETNQNPPRCRKLCHITPLCRHGQNQKPESTPSSPCPRCQELVWRPCVGHHLAAEKMAKLNLDAIIYVETVFHVGTITIRLPVIPWK


· CDS sequence: (2424 bp)


>Lmscaffold98.737
ATGAGATTCAACTTCGATAAGACAGAGGATACGCCGGATTCACGGCGATCTCCGACGTCGAAAGAGCCGGTTCAATGGGTTCCTCTCCAAAGCCACCCAATTTTTTCTTTTCTTCCTTCTTCCCAGGATGAATCCGCCTCGTCGCAGAGGTTTCCGAAGAATTTCATGGCTTGGGACGGAGACTCAAGACTATATTACTGGGATTCTAAACGATATCTCCTTCACCGATTGTCTCTACGCTTAGGTGAACCTGAACCATCCTCCATCCTCGCCGCAATCCCCTCTAAGGTGATGCAACCAGATATCCAGCTGACATTTTCTGTTAACAAAATCTCCATCAATAAGTCGGGATCAGCTTTACTTCTTGCCGGTTCAGATGGGATATGTGTGATGTATCTTTTTGGCCGTGCTTCTGTAATAGAAGACAATATTATTTGCAGGGTAGTTTCTACTGGTTCAGAAATCTATTCAAGTGGTGACAGTGTCATACACTTGCTACAAGCATCGTGGCACCCTGATAGTGACACCCATTTGGGAATTCTATCCTCGGATGCAGTTTTCAGACTTTTCGATTTGTCTTCTGATGCTGAGATACCAGAGCAAGAATACTATCTACAGCCTGTTGAACCAGAAAGATCTAGAACAGCTTCATCAATTTATCCTGCTGATTTCAGTTTCGGAGGAGATCATCTGTGGGATAAATTTACTGTCTTTATATTATTCAATGATGGTTCAATTTATATCCTGTGCCCAGTTGTGCCATTTGGAAGTATTTACAAATGGGAATCGATAATGGAGATTCACAATGATGCTAATATGTTTGGGGTCAAATCACCTAACTCGATAGCTGCTAACAACTCCAGTCTGGCAATTGATTGGTTGGAAGCTGTATTTCCAGATTTGACTGAACAAGGAACTAGGGGTGATAATATAACGGTAGTGAAAGCCCATCCTTATGCTTTGCTTGACTCATCATTGGCTTTACAGGGTCCTTTATACAAAGCATCAGGTGGTGAAGGAGATGAAAATTTAGCTGTTCGGGAGGCAGAATATAAAGGCCGGGCTGTGAGTCTGTTATATAATCTTGTCAGCAAAGATTCAATTCTGGTAACTGCCTGGAGTGGTGGACAATTACAGGTTGATGCTTTGGTCGATGAAATCCAACCAGTTTGGATCTCTGGTAGCTCATCTCGTCTTCGCATGAACTCCCACGACAAAATTCAAGGGGTTGCAATGATTTGTGAGTCAAACGCAGGTGAGCTTCCAGTAGCGACTTCAAACCTTCCGCTTGATCACACTGTTTGGTTAGGGCATCTACCACCACTGTTAAGGCTAGCGGTGGTTGATTTGGCTCTACCCACAAATCGTGAAGGTGGTTCTCTTGTTACCTTGTTCGCTGACTCCCTTTTGCCAGAACGAATATACTCCCTCCATGATGGTGGCATTGATTCAACAGTCTTACACTCTCTTCCCTTCACAAGTCAGGCCACGGAAAAAGATGAAGCTCTCAAAACGCCATCTGTTCACACTGTGCTAAGTACATGCCAAGAAGATTCCGCTGCATGTTCTCTGTTGGGATTTGTACCTTTGTCAGATTCGTTTGGGTATGCATGGATCATTGCAGTCTTATCCTCAGGAGAATGCATTGTAGCAGAGATGAAAACTTGGGATCTCTTTCTTCCAATTCATGTCAGTACAGATAAGACAGAGTCCTCCGGTGTAATTGAGCAGAAAGAGCAAGATTCCCCGTGCATCATAAGCAAGGACCTCCTTGCTGGTCCCAAAGTAAGAATTGCTCCTCATGCGTTACCTAACCAGCGTTCGGCTCCAGCCAATTCCGTTGAAGGCCGATCAATTTTGCATCACTATGTCAAGCTTTTCCATGAAAACTACGTCGAATATGCGCACAAGGTCTTCTTCGAGTTGCAGCATCATGCTCCTAACGTGAAGAGAATAATTGATGACCAACACCAGCGGCTTTCAGAGGCAAATCAGAAAATGTCTAAAGTCGAGAAGAACCAAACCTTGCTGGAGAAAAGGATTGACAAAGCAATTCAAATACATGATTCTCTTGAGCAACGATTGCAACGTCTCCGTAGCTTGCCTAGTACACATAAGAGACCTCTGACGAGAGCAGAACGAGATTTCAAGTCGGAGCTCGATCAATTCGCTGGAGTTGAAGTGGATGCACTTCAATCATCTATTGAAACACTGAGAGCAAGAGTGAGAAAGTCAGGTCAAAAATCTCCCAAAAGCAGAGTCGTTGCAAGTACTCAGAAAAAGCAGCACTCAAAGAAAAATTACATTCAAGATACAGAAATGTCACAGCTTCAATCCACACTCTTCAAACTATCCCTCATGAACAGTGATAACTCCAAAAAGGTCAAGATCGTAGAATCAGCACTGAAGTCACAAGAGAGTTAA


· Genomic location:


scaffold98:4881772:4884513:+